Table 1

Oligonucleotide sequences
Name Length 5′→3′ sequence

<a onClick="popup('http://www.nanoscalereslett.com/content/8/1/210/mathml/M1','MathML',630,470);return false;" target="_blank" href="http://www.nanoscalereslett.com/content/8/1/210/mathml/M1">View MathML</a>

(1)

(L mol−1m−1)

ϵ260
(L mol−1m−1) (mM−1cm−1)
C1A 39 ACAGTAGAGATGCTGCTGATTCGTTCATGTGCTTCAAGC 3.732 × 107 373.2
C1B TGTCATCTCTACGACGACTAAGCAAGTACACGAAGTTCG 3.769 × 107 376.9
SQ1A 39 CAGTAGAGATGCTGCTGA
    GGGGGGGG
TGTGCTTCAAGCG
3.799 × 107 379.9
SQ1B CTCTACGACGACT
    GGGGGGGG
ACACGAAGTTCGCTACTG
3.732 × 107 373.2
C2 29 TCTACGACGACT
    GGGGGGGG
ACACGAAGT
2.856 × 107 285.6

The G-box region in each sequence is underlined. aExtinction coefficients for single-stranded oligonucleotide in SI units.

Mendez and Szalai

Mendez and Szalai Nanoscale Research Letters 2013 8:210   doi:10.1186/1556-276X-8-210

Open Data