Table 1

Primers used in real-time qPCR analyses
Gene name Primer forward Codified protein GenInfo identifier
Primer reverse
gapA TTGGCCGTATCGGTCGCATT Glyceraldehyde-3-phosphate dehydrogenase A 16129733
AAACGGCCGTGAGTGGAGTC
ompC TAACGGCGACCGTGCTGAAA Outer membrane porinprotein C 16130152
ACGCGAGTTGCGTTGTAGGT
luxS ACCGTGTTCGATCTGCGCTT S-ribosylhomocysteinelyase 16130599
GCAAACAGGTGCTCCAGGGT
murA AACGAAGCTCCAGGGCGAAG UDP-N-acetylglucosamine 1-carboxyvinyltransferase 16131079
TTCGCACCCAGCTGGCTTAG
fliC CAGTTCTCCAACCGCGGTCA Flagellar filament structural protein (flagellin) 16129870
GAGCCTCACCACCAGCAGTC
lpxC GCAACCAGCGCTATGCGATG UDP-3-O-acyl N-acetylglucosaminedeacetylase 16128089
AGGCACAAACCACGGGACTG
slp CCGACTGCTCGCCAGACAAA Outer membrane lipoprotein 90111603
CACACCTGGATGCCCTGCAT
flu TGCCGGCACGGTCCGGGATGA CP4-44 prophage; antigen 43 (Ag43) phase-variable biofilm formation autotransporter 49176177
GCCCCGGGCGCGGAAGTCGT
cpxP GGCCCGGCACGAACAGCCTCCT Periplasmic adaptor protein 49176443
ACCGCTTGCTGCTCCGGCGT
dsbA CACAAGGCCGGGGCGCGTGG Oxidoreductase that catalyzes reoxidation of DsbA protein disulfide isomerase I 49176085
AGCGCAGCACCCAGAACGCCGA
degP GCGCTGGGGCGTAGCGGCCT Serine endoprotease (protease Do), membrane-associated 16128154
TGCCGCCGTCCGGTGCGAGG
cpxR TCTGGCTGACGCTGGCGCTGGT Sensory histidine kinase/signal sensing protein 16129840
CGCCCGGAACAGACGCCGCCA
fimE GTTACGGGGCAACGGGAGCC Tyrosine recombinase/inversion of on/off regulator of fimA 16132134
CTGGGTCCAGCGTTCCACGG

Rizzello et al.

Rizzello et al. Nanoscale Research Letters 2012 7:575   doi:10.1186/1556-276X-7-575

Open Data