Table 1

Primer sequences for the investigated genes
Gene symbol Gene IDa Size (bp) Primer sequence (5’ to 3’)
ACTB 396526 ca. 169 forward: GTCCACCTTCCAGCAGATGT
reverse: ATAAAGCCATGCCAATCTCG
EEF1A2 419244 ca. 85 forward: AGCAGACTTTGTGACCTTGCC
reverse: TGACATGAGACAGACGGTTGC
FGF2 396413 ca. 151 forward: GGCACTGAAATGTGCAACAG
reverse: TCCAGGTCCAGTTTTTGGTC
VEGFA 395909 ca. 194 forward: TGAGGGCCTAGAATGTGTCC
reverse: TCTTTTGACCCTTCCCCTTT

aNCBI resources.

Hotowy et al.

Hotowy et al. Nanoscale Research Letters 2012 7:418   doi:10.1186/1556-276X-7-418

Open Data