Table 1

Primers for 18S rDNA templates

Namea

Sequence (5' to 3')


390F

AGCCTGAGAAACGGCTAC

434F

CAAATTACCCAATCCTGAC

995F

ACGATCAGATACCGTCCTA

542R

GATCCTCGTTAAGGGATTTA

1036R

TCGGCATCGTTTATGGTT

1304R

ACAAATCGCTCCACCAAC


aIn primer names, the number indicates the position of primer on the template. The letter (F or R) indicates the forward or reverse primer, respectively

Liang et al. Nanoscale Res Lett 2011 6:51   doi:10.1007/s11671-010-9797-5

Open Data