Table 1

Gene-specific primers used to amplify the miRNAs

Gene

Forward primer (5' → 3')

Reverse primer (5' → 3')


RT-miR-26a

CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGAGCCTATC

miR-26a

ACACTCCAGCTGGGTTCAAGTAATCCAGGA

TGGTGTCGTGGAGTC

U6

GCTTCGGCAGCACATATACTAAAAT

CGCTTCACGAATTTGCGTGTCAT


Liang et al. Nanoscale Research Letters 2011 6:447   doi:10.1186/1556-276X-6-447

Open Data