Table 1

Target oligonucleotide sequences
ssDNA No. Sequence (5′-3′)
175wd GGCACCCGCGTCCGCGCCATGGCCATCTAC
175G–A 1 GGCACCCGCGTCCCGCCATGGCCATCTAC
245wd TGCATGGGCGGCATGAACCGGAGGCCCATC
245G–T 2 TGCATGGGCGCATGAACCGGAGGCCCATC
245G–A 3 TGCATGGGCGCATGAACCGGAGGCCCATC
248wd GCATGAACCGGAGGCCCATCCTCACCATCA
248G–A 4 GCATGAACCGAGGCCCATCCTCACCATCA
248G–T 5 GCATGAACCGAGGCCCATCCTCACCATCA
248C–T 6 GCATGAACGGAGGCCCATCCTCACCATCA
249wd GCATGAACCGGAGGCCCATCCTCACCATCA
249G1–T 7 GCATGAACCGGAGCCCATCCTCACCATCA
249G2–T 8 GCATGAACCGGAGCCCATCCTCACCATCA
249G-C 9 GCATGAACCGGAGCCCATCCTCACCATCA
273wd GAACAGCTTTGAGGTGCGTGTTTGTGCCTG
273G–T 10 GAACAGCTTTGAGGTGCTGTTTGTGCCTG
273G–A 11 GAACAGCTTTGAGGTGCTGTTTGTGCCTG
282wd TCCTGGGAGAGACCGGCGCACAGAGGAAGA
282C–T 12 TCCTGGGAGAGACGGCGCACAGAGGAAGA

The underline corresponds to the single base mismatch comparing with the wildtype (wd). 12 of the most frequent point mutations in exon 5, 7, and 8 of human p53 gene are included. 248wd and 249wd are the same sequences. The mutant sequences are numbered from 1 to 12

Sun et al.

Sun et al. Nanoscale Research Letters 2008 4:216-220   doi:10.1007/s11671-008-9228-z

Open Data